DR. VINCENT AGNELLO, M.D.
Medical Practice at Mall Rd, Burlington, MA
License number
Massachusetts 35541
Category
Medical Practice
Type
Specialist
Address
Address
2
41 Mall Rd, Burlington, MA 01805
11 French Rd, Cherry Brook, MA 02493
11 French Rd, Cherry Brook, MA 02493
Phone
(781) 273-8887
Professional information
Prognostic Marker For Cryoglobulinemic Vasculitis And B Cell Malignancies In Hcv Infected Patients
US Patent:
2013005, Feb 28, 2013
Filed:
Feb 28, 2011
Appl. No.:
13/581759
Inventors:
Vincent Agnello - Weston MA, US
Assignee:
Vincent Agnello - Weston MA
International Classification:
C12Q 1/70, A61P 13/12, A61P 17/00, A61K 39/395
US Classification:
4241731, 435 5
Abstract:
The invention provides methods and compositions for early diagnosis and treatment of a disease associated with a specific antibody by employing the detection of a cross-idiotypic epitope on the specific antibody to detect the cells that produce the antibody before the development of clinical symptoms of the disease.
Vincent Agnello, Bedford MA
Specialties:
Internal Medicine, Rheumatology
Work:
Edith Nourse Rogers Memorial Veterans Hospital
200 Springs Rd, Bedford, MA 01730 Lahey Clinic
41 Mall Rd, Burlington, MA 01803
200 Springs Rd, Bedford, MA 01730 Lahey Clinic
41 Mall Rd, Burlington, MA 01803
Education:
University of Rochester(1964)
Dr. Vincent Agnello, Burlington MA - MD (Doctor of Medicine)
Specialties:
Internal Medicine
Address:
41 Mall Rd, Burlington 01805
(781) 273-8887 (Phone), (781) 744-5208 (Fax)
200 Springs Rd, Bedford 01730
(781) 687-2000 (Phone)
(781) 273-8887 (Phone), (781) 744-5208 (Fax)
200 Springs Rd, Bedford 01730
(781) 687-2000 (Phone)
Certifications:
Internal Medicine, 1974
Awards:
Healthgrades Honor Roll
Languages:
English
Hospitals:
41 Mall Rd, Burlington 01805
200 Springs Rd, Bedford 01730
Lahey Hospital & Medical Center
41 Mall Rd, Burlington 01805
200 Springs Rd, Bedford 01730
Lahey Hospital & Medical Center
41 Mall Rd, Burlington 01805
Education:
Medical School
University of Rochester
Graduated: 1964
Vanderbilt U Hosp
New York Hospital
Rockefeller U
University of Rochester
Graduated: 1964
Vanderbilt U Hosp
New York Hospital
Rockefeller U
Method Of Inhibiting Infection By Hcv, Other Flaviviridae Viruses, And Any Other Virus That Complexes To Low Density Lipoprotein Or To Very Low Density Lipoprotein In Blood By Preventing Viral Entry Into A Cell
US Patent:
2011022, Sep 22, 2011
Filed:
Feb 26, 2009
Appl. No.:
12/380346
Inventors:
Vincent Agnello - Weston MA, US
International Classification:
A61K 39/395, C12N 5/071, A61K 38/17, A61P 31/12, A61P 31/14
US Classification:
4241391, 435375, 4241721, 514 37
Abstract:
A method of inhibiting infection by Flaviviridae viruses including HCV, GBC/HGV, and BVD in addition to VSV and any other virus capable of forming a complex with a lipoprotein strategies: preventing formation of a complex should one form, altering the conformation of such a complex to prevent its interaction with the cell receptor, blocking the cell receptor for the complex using an antibody to the receptor, blocking binding of the lipoprotein complex to the cell receptor using soluble lipoprotein receptor or fragments thereof, or downregulating the LDL receptor activity of the cells.
Method Of Inhibiting Infection By Hcv, Other Flaviviridae Viruses, And Any Other Virus That Complexes To Low Density Lipoprotein Or To Very Low Density Lipoprotein In Blood Preventing Viral Entry Into A Cell
US Patent:
2008021, Sep 4, 2008
Filed:
Jun 20, 2007
Appl. No.:
11/820987
Inventors:
Vincent Agnello - Weston MA, US
International Classification:
A61K 39/395, C12N 5/06, A61K 38/00, A61P 37/00
US Classification:
4241721, 435375, 514 12
Abstract:
A method of inhibiting infection by Flaviviridae viruses including HCV, GBC/HGV, and BVD in addition to VSV and any other virus capable of forming a complex with a lipoprotein strategies: preventing formation of a complex should one form, altering the conformation of such a complex to prevent its interaction with the cell receptor, blocking the cell receptor for the complex using an antibody to the receptor, blocking binding of the lipoprotein complex to the cell receptor using soluble lipoprotein receptor or fragments thereof, or downregulating the LDL receptor activity of the cells.
Method Of Inhibiting Infection By Hcv, Other Flaviviridae Viruses, And Any Other Virus That Complexes To Low Density Lipoprotein Or To Very Low Density Lipoprotein In Blood Preventing Viral Entry Into A Cell
US Patent:
2005004, Mar 3, 2005
Filed:
Oct 24, 2001
Appl. No.:
10/398200
Inventors:
Vincent Agnello - Weston MA, US
International Classification:
A61K039/42
US Classification:
424159100
Abstract:
A method of inhibiting infection by Flaviviridae viruses including HCV, GBC/HGV, and BVD in addition to VSV and any other virus capable of forming a complex with a lipoportein strategies: preventing formation of a complex should one form, altering the conforamtion of such a complex to prevent its interacton with the cell receptor, blocking the cell receptor for the complex using an antibody to the receptor, blocking binding of the lipoprotein complex to the cell receptor using soluble lipoprotein receptor or framents thereof, or downregulating the LDL receptor activity of the cells.
Chemiluminescent Assay For Dsdna Antibodies
US Patent:
6030773, Feb 29, 2000
Filed:
Jul 8, 1992
Appl. No.:
7/911667
Inventors:
Vincent Agnello - Weston MA
International Classification:
C12Q 168, G01N 3353
US Classification:
435 6
Abstract:
An assay for systemic lupus erythematosus based upon capture of the anti-dsDNA portion of IgG in a human serum specimen by the Fc part of a molecule using solid phase immobilized F(ab')2 fragment of anti-human IgG specific for Fc, the captured IgG being then incubated with a synthetic dsDNA tagged with a moiety from which a signal proportional to the quantity of said synthetic dsDNA can be elicited. Upon eliciting a signal from the moiety, the amount of antibody to dsDNA can be quantified, providing diagnostic and prognostic information regarding the disease.
Probe For Detecting Hepatitis C Virus In Tissues
US Patent:
6096498, Aug 1, 2000
Filed:
Jun 29, 1998
Appl. No.:
9/106566
Inventors:
Vincent Agnello - Weston MA
International Classification:
C12Q 170, C12Q 168, C12P 1934
US Classification:
435 5
Abstract:
A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT and 3' antisense, ccagagcatctggcacgtgg primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.
Method Of Detecting Hepatitis C Virus In Tissues
US Patent:
5830635, Nov 3, 1998
Filed:
Mar 31, 1995
Appl. No.:
8/414441
Inventors:
Vincent Agnello - Weston MA
International Classification:
C12Q 170, C12Q 168, C12P 1934
US Classification:
435 5
Abstract:
A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT (SEQ ID NO:1) and 3' antisense, CCAGAGCATCTGGCACGTGG (SEQ ID NO:2) primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.